BRESEQ :: Evidence
Predicted mutation
evidence seq id position mutation freq annotation gene description
RA NC_012967 3,762,741 A→T 100% K662I (AAA→ATA)  spoT → bifunctional GTP diphosphokinase/guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase

Read alignment evidence...
  seq id position ref new freq score (cons/poly) reads annotation genes product
*NC_0129673,762,7410AT92.2% 23.7 / ‑5.6 11K662I (AAA→ATA) spoTbifunctional GTP diphosphokinase/guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase
Reads supporting (aligned to +/- strand):  ref base A (0/0);  major base T (7/3);  minor base G (0/1);  total (7/4)
Fisher's exact test for biased strand distribution p-value = 3.64e-01
Kolmogorov-Smirnov test that lower quality scores support variant p-value = 1.00e+00
Rejected as polymorphism: E-value score below prediction cutoff.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.

TCGAATATTCAAAGTTTGAATACGGAAGAGAAAGATGGTCGCGTCTACAGCGCCTTTATTCG  >  NC_012967/3762710‑3762771
                               |                              
tCGAATATTCAAAGTTTGAATACGGAAGagatagat                            <  1:349403/36‑1 (MQ=38)
 cGAATATTCAAAGTTTGAATACGGAAGAGATAGATg                           <  1:51621/36‑1 (MQ=38)
  gAATATTCAAAGTTTGAATACGGAAGAGATAGATgg                          >  2:413795/1‑36 (MQ=38)
       ttCAAAGTTTGAATACGGAACAGGTAGATGGTcggt                     >  2:215954/1‑34 (MQ=16)
         cAAAGTTTGAATACGGAAGAGATAGATGGTCGCGTc                   <  2:528769/36‑1 (MQ=38)
               ttGAATACGGAAGAGATAGATGGTCGCGTCTATAgc             >  2:544213/1‑36 (MQ=25)
               ttGAATACGGAAGAGATAGATGGTCGCGTCTACAgc             <  1:138356/36‑1 (MQ=38)
                tGAATACGGAAGAGATAGATGGTCGCGTCTACAgcg            >  2:357014/1‑36 (MQ=38)
                tGAATACGGAAGAGAGAGATGGTCGCGTCTACAgcg            <  1:59172/36‑1 (MQ=39)
                   aTACGGAAGAGATAGATGGTCGCGTCTACAGTGCCt         >  2:353043/1‑36 (MQ=25)
                       ggAAGAGATAGATGGTCGCGTCTACAGCGCCTTTAt     >  2:560346/1‑36 (MQ=39)
                          agagATAGATGGTCGCGTCTACAGCGCCTTTATTCg  >  2:72052/1‑36 (MQ=39)
                               |                              
TCGAATATTCAAAGTTTGAATACGGAAGAGAAAGATGGTCGCGTCTACAGCGCCTTTATTCG  >  NC_012967/3762710‑3762771

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 8 ≤ ATCG/ATCG < 15 ≤ ATCG/ATCG < 27 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑