Predicted mutation
evidence	seq id	position	mutation	freq	annotation	gene	description
RA	NC_012967	3,762,741	A→T	100%	K662I (AAA→ATA)	spoT →	bifunctional GTP diphosphokinase/guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase

Read alignment evidence...
	seq id	position		ref	new	freq	score (cons/poly)	reads	annotation	genes	product
*	NC_012967	3,762,741	0	A	T	92.2%	23.7 / ‑5.6	11	K662I (AAA→ATA)	spoT	bifunctional GTP diphosphokinase/guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase
Reads supporting (aligned to +/- strand):  ref base A (0/0);  major base T (7/3);  minor base G (0/1);  total (7/4)
Fisher's exact test for biased strand distribution p-value = 3.64e-01
Kolmogorov-Smirnov test that lower quality scores support variant p-value = 1.00e+00
Rejected as polymorphism: E-value score below prediction cutoff.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.

TCGAATATTCAAAGTTTGAATACGGAAGAGAAAGATGGTCGCGTCTACAGCGCCTTTATTCG  >  NC_012967/3762710‑3762771                                |                               tCGAATATTCAAAGTTTGAATACGGAAGagatagat                            <  1:349403/36‑1 (MQ=38)  cGAATATTCAAAGTTTGAATACGGAAGAGATAGATg                           <  1:51621/36‑1 (MQ=38)   gAATATTCAAAGTTTGAATACGGAAGAGATAGATgg                          >  2:413795/1‑36 (MQ=38)        ttCAAAGTTTGAATACGGAACAGGTAGATGGTcggt                     >  2:215954/1‑34 (MQ=16)          cAAAGTTTGAATACGGAAGAGATAGATGGTCGCGTc                   <  2:528769/36‑1 (MQ=38)                ttGAATACGGAAGAGATAGATGGTCGCGTCTATAgc             >  2:544213/1‑36 (MQ=25)                ttGAATACGGAAGAGATAGATGGTCGCGTCTACAgc             <  1:138356/36‑1 (MQ=38)                 tGAATACGGAAGAGATAGATGGTCGCGTCTACAgcg            >  2:357014/1‑36 (MQ=38)                 tGAATACGGAAGAGAGAGATGGTCGCGTCTACAgcg            <  1:59172/36‑1 (MQ=39)                    aTACGGAAGAGATAGATGGTCGCGTCTACAGTGCCt         >  2:353043/1‑36 (MQ=25)                        ggAAGAGATAGATGGTCGCGTCTACAGCGCCTTTAt     >  2:560346/1‑36 (MQ=39)                           agagATAGATGGTCGCGTCTACAGCGCCTTTATTCg  >  2:72052/1‑36 (MQ=39)                                |                               TCGAATATTCAAAGTTTGAATACGGAAGAGAAAGATGGTCGCGTCTACAGCGCCTTTATTCG  >  NC_012967/3762710‑3762771

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 8 ≤ ATCG/ATCG < 15 ≤ ATCG/ATCG < 27 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑