BRESEQ :: Evidence
Predicted mutation
evidence seq id position mutation freq annotation gene description
RA NC_012967 430,835 C→T 100% intergenic (‑48/‑108) ECB_RS02045 ← / → lon IS4 family transposase/endopeptidase La

Read alignment evidence...
  seq id position ref new freq score (cons/poly) reads annotation genes product
*NC_012967430,8350CT100.0% 22.6 / ‑6.7 12intergenic (‑48/‑108)ECB_RS02045/lonIS4 family transposase/endopeptidase La
Reads supporting (aligned to +/- strand):  ref base C (0/0);  major base T (3/8);  minor base A (0/1);  total (3/9)
Rejected as polymorphism: E-value score below prediction cutoff.
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.

ACCACAACCCTTAAGTTAGCGCTTATGGGGAAACATCCCCATATACTGAC  >  NC_012967/430816‑430865
                   |                              
aCCACAACCCTTAAGTTAGTGCTTATGGGGAAACAt                <  2:752505/36‑1 (MQ=17)
 ccACAACCCTTAAGTTAGTGCTTATGGGGAAACATc               <  2:657739/36‑1 (MQ=18)
   acaACCCTTAAGTTAGTGCTTATGGGGAAACATccc             <  1:234101/36‑1 (MQ=18)
   acaACCCTTAAGTTAGTGCTTATGGGGAAACATccc             >  1:732140/1‑36 (MQ=18)
      aCCCTTAAGTTAGTGCTTATGGGGAAACATCCCCat          >  2:610058/1‑36 (MQ=25)
      aCCCTAAAGTTAGTGCTTATGGGGAAACATCCCCat          <  2:119741/36‑1 (MQ=25)
        ccTTAAGTTAGTGCTTATGGGGAAACATCCCCatat        <  2:34943/36‑1 (MQ=37)
         catAAGATAGAGCTTAAGGGGAAACATCCCCAtata       <  1:567568/34‑1 (MQ=16)
         cTTAAGTTAGTGCTTATGGGGAAACATCCCCAtata       <  2:566871/36‑1 (MQ=37)
         cTTAAGTTAGTGCTTATGGGGAAACATCCCCAtata       >  1:306391/1‑36 (MQ=37)
         cTTAAGTTAGTGCTTATGGGGAAACATCCCCAtata       <  2:805209/36‑1 (MQ=37)
              gTTAGTGCTTATGGGGAAACATCCCCATATACTGAc  <  1:48810/36‑1 (MQ=39)
                   |                              
ACCACAACCCTTAAGTTAGCGCTTATGGGGAAACATCCCCATATACTGAC  >  NC_012967/430816‑430865

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 10 ≤ ATCG/ATCG < 18 ≤ ATCG/ATCG < 27 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑