| Predicted mutation | |||||||
|---|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | freq | annotation | gene | description |
| MC JC | NC_012967 | 3,289,962 | Δ16 bp | 100% | coding (3‑18/4461 nt) | gltB → | glutamate synthase large subunit |
| Missing coverage evidence... | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_012967 | 3289962 | 3289977 | 16 | 10 [0] | [0] 10 | gltB | glutamate synthase large subunit |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_012967 | = 3289961 | 0 (0.000) | 9 (0.940) | 9/50 | NT | 100% | coding (2/4461 nt) | gltB | glutamate synthase large subunit |
| ? | NC_012967 | 3289978 = | 0 (0.000) | coding (19/4461 nt) | gltB | glutamate synthase large subunit | |||||
TGGGGGAGGTTCACGATATGTTGTACGATAAATCCCTTGAGAGGGATAACTGTGGTTTC > NC_012967/3289943‑3290001 | gggttcccgcagagcctgggggaggttcacgatatc < 2:396819‑M2/1‑1 (MQ=255) cccgcagagcctgggggaggttcacgatatCTTgag < 1:321637‑M2/6‑1 (MQ=255) ccgcagagcctgggggaggttcacgatatCTTgaga > 1:728798‑M2/30‑36 (MQ=255) cgcagagcctgggggaggttcacgatatCTTGagag > 2:733878‑M2/29‑36 (MQ=255) cctgggggaggttcacgatatCTTGAGAGGGATAAc < 2:770294‑M2/15‑1 (MQ=255) ctgggggaggttcacgatatCTTGAGAGGGTTAACt > 2:188883‑M2/21‑36 (MQ=255) gggggaggttcacgatatCTTGAGAGGGATAACtgt > 1:925597‑M2/19‑36 (MQ=255) ggaggttcacgatatCTTGAGAGGGATAACTGTGGt < 1:500979‑M2/21‑1 (MQ=255) aggttcacgatatCTTGAGAGGGATAACTGTGGttt > 1:280225‑M2/14‑36 (MQ=255) ggttcacgatatCTTGAGAGGGATAACTGTGGTTTc < 2:968407‑M2/24‑1 (MQ=255) | TGGGGGAGGTTCACGATATGTTGTACGATAAATCCCTTGAGAGGGATAACTGTGGTTTC > NC_012967/3289943‑3290001 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 16 ≤ ATCG/ATCG < 21 ≤ ATCG/ATCG < 30 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |