| Predicted mutation | |||||||
|---|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | freq | annotation | gene | description |
| MC JC | NC_012967 | 3,894,998 | Δ6,934 bp | 100% | rbsD–[mdtD] | rbsD, rbsA, rbsC, rbsB, rbsK, rbsR, [mdtD] | |
| Missing coverage evidence... | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_012967 | 3894998 | 3901931 | 6934 | 13 [0] | [0] 14 | rbsD–[mdtD] | rbsD,rbsA,rbsC,rbsB,rbsK,rbsR,[mdtD] |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_012967 | = 3894997 | 0 (0.000) | 4 (0.470) | 3/44 | NT | 100% | intergenic (+27/‑161) | ECB_RS25215/rbsD | IS3 family transposase/D‑ribose pyranase |
| ? | NC_012967 | 3901932 = | 0 (0.000) | coding (488/1428 nt) | mdtD | multidrug transporter subunit MdtD | |||||
CTATGGGGATATTGATTAAAAATATCCAGTGCCAGGTTGCCCAGGTGACCAGCACGCCGCCAAGAACGGGG > NC_012967/3901897‑3901967 | gtgtttaactgtccaactttttggggtcagtacagg < 2:92476‑M2/1‑1 (MQ=255) tttttaactgtccaactttttggggtcagtacagGt < 2:507901‑M2/2‑1 (MQ=255) tgcttaactgtccaacttcttggggtcagtacagGt > 2:192327‑M2/35‑36 (MQ=255) gtttaactgtccaactttttggggtcagtacagGtt > 2:682036‑M2/34‑36 (MQ=255) tttaactgtccaactttttggggtcagtacagGTTg < 1:40355‑M2/4‑1 (MQ=255) aactgtccaactttttggggtcagtacagGTTGccc > 2:187745‑M2/30‑36 (MQ=255) aactgtccaactttttgcggtcagtacagGTTGccc > 2:295431‑M2/30‑36 (MQ=255) ctttttggggtcagtacagGTTGCCCAGGTGACCAg < 1:203217‑M2/17‑1 (MQ=255) ggggtcagtacagGTTGCCCAGGTGACCAGCAcgcc < 1:768231‑M2/23‑1 (MQ=255) acagGTTGCCCAGGTGACCAGCACGCCGCCAAGAAc < 1:404236‑M2/32‑1 (MQ=255) cagGTTGCCCAGGTGACCAGCACGCCGCCAAGAACg > 1:947199‑M2/4‑36 (MQ=255) gGTTGCCCAGGTGACCAGCACGCCGCCAAGAACggg > 1:776216‑M2/2‑36 (MQ=255) gGTTGCCCAGGTGACCAGCACGCCGCCAAGAACggg > 2:695312‑M2/2‑36 (MQ=255) gTTGCCCAGGTGACCAGCACGCCGCCAAGAACgggg < 1:353164/36‑1 (MQ=255) | CTATGGGGATATTGATTAAAAATATCCAGTGCCAGGTTGCCCAGGTGACCAGCACGCCGCCAAGAACGGGG > NC_012967/3901897‑3901967 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 12 ≤ ATCG/ATCG < 21 ≤ ATCG/ATCG < 29 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |